heptapeptide comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Last reviewed on 2025-12-22. Where a claim depends on a specific study, the study is described rather than over-claimed.
Semax is a synthetic heptapeptide with the sequence Met-Glu-His-Phe-Pro-Gly-Pro. Its chain combines the first seven residues of corticotropin with a C-terminal proline-glycine-proline extension, a modification intended to slow enzymatic breakdown. The free peptide has a molecular mass near 813.9 daltons. It belongs to the class of ACTH-derived fragments studied for central nervous system activity rather than for adrenal steroid stimulation. This structural relationship to a natural hormone fragment is the usual starting point for describing the compound in the literature.
Development took place during the 1980s at institutes of the Russian Academy of Sciences, where peptide fragments of ACTH were screened for cognitive and neuroprotective effects. The compound received regulatory approval in Russia as a nasal preparation, marketed for conditions such as ischemic stroke, transient ischemic attacks, and optic nerve disorders. Registration in other countries has not followed. Most published clinical reports originate from a small number of Russian research groups, and independent replication outside that setting remains limited. The regulatory status therefore differs sharply between Russia and the rest of the world.
The peptide is prone to several degradation pathways. Oxidation of the methionine residue produces a sulfoxide that elutes close to the parent peak in many chromatographic systems. Hydrolysis of peptide bonds and deamidation of susceptible residues in related sequences also reduce purity over time. Lyophilised material kept dry at minus twenty degrees Celsius and shielded from light is the most stable form commonly described in laboratory practice.
Material sold for laboratory use varies widely in stated purity and documentation. A certificate of analysis should list the analytical method, the column and detector used, and the observed purity value. Independent verification by an outside laboratory is the practical way to confirm identity when documentation is absent or internally inconsistent. Regulatory status differs by country, and a product legal in one jurisdiction may be unapproved or controlled in another.
Identity and purity of semax are established with reversed-phase high-performance liquid chromatography coupled to ultraviolet detection, usually at 214 nanometres. Mass spectrometry, most often electrospray ionisation in positive mode, confirms the molecular mass and reveals truncated sequences. Amino acid analysis and peptide mapping after enzymatic digestion provide additional structural confirmation. Laboratories typically report purity as the percentage area of the main peak, a figure that does not capture isomeric or oxidised variants unless the method resolves them.
| Property | Value | Notes |
|---|---|---|
| Sequence | Met-Glu-His-Phe-Pro-Gly-Pro | Heptapeptide; ACTH(4-10) analog extended at C-terminus |
| Molecular mass | ~813.9 Da | Free peptide, unmodified |
| Appearance | White to off-white powder | Typical lyophilized solid |
| Solubility | Soluble in water and saline | Also soluble in common aqueous buffers |
| Storage (solid) | -20 °C, desiccated | Protect from moisture and repeated thawing |
Regulatory status differs sharply between jurisdictions. In Russia the peptide is registered as a prescription nasal preparation, while agencies such as the United States Food and Drug Administration have not approved it for any indication. Products sold elsewhere are typically labeled for laboratory research only, and such labels shift responsibility for safe handling to the purchaser. Because the same name covers pharmaceutical-grade nasal drops and bulk research powder, identity and purity documentation becomes the main practical concern when comparing sources.
Semax is a synthetic seven-amino-acid peptide whose sequence extends the ACTH(4-10) fragment with a C-terminal proline-glycine-proline tripeptide. The commonly cited sequence is Met-Glu-His-Phe-Pro-Gly-Pro, giving a molecular formula near C37H51N9O10S and a molecular weight close to 813.9 g/mol. It belongs to the broader class of synthetic ACTH fragments studied for central nervous system effects rather than for adrenal steroid stimulation. In practice the material appears as a lyophilized white powder for laboratory work or as a dilute saline solution in clinical settings.
Published studies are dominated by animal models of stroke, ischemia, and cognitive impairment, with a smaller number of human trials conducted in Russia. Many of the human reports are small, single-center, and published in Russian-language journals, which limits independent scrutiny. Outcome measures vary between studies and often rely on clinician-rated scales rather than objective biomarkers. Systematic reviews have noted the methodological weaknesses and called for larger, preregistered trials before firm conclusions can be drawn.
Claims about enhanced focus, memory, or mood in healthy people rest mostly on anecdotal reports and community discussion rather than on controlled data. It remains unclear whether any cognitive benefit observed in patients recovering from brain injury would extend to uninjured users. Dose-response relationships, long-term safety, and interactions with other drugs are not well characterized in the peer-reviewed literature. Questions about optimal route of administration and treatment duration likewise remain open.
Clinical reports describe use in ischaemic stroke, transient ischaemic attack, optic nerve conditions, and cognitive complaints, but most of these studies are small and were conducted in a single region. Systematic reviews have generally described the evidence base as limited in size and variable in methodological quality. Randomised controlled data suitable for international regulatory assessment are scarce. As a result, major treatment guidelines outside Russia do not include the peptide, and interest in it remains largely research-driven rather than routine clinical.
Semax is a synthetic heptapeptide with the sequence Met-Glu-His-Phe-Pro-Gly-Pro. It is described in the literature as an analogue of the ACTH(4–10) fragment, a short N-terminal portion of adrenocorticotropic hormone that retains some neurotropic activity without the full hormonal effects of the parent peptide. The molecule carries a methionine residue at the N-terminus and two proline residues near the C-terminus, features that shape both its interactions with receptor systems and its chemical stability. The free peptide corresponds to the formula C37H51N9O10S and a molecular mass near 813.9 Da.
The College of Allied Health Sciences (CAHS) provides education for allied health and health science professionals. CAHS became a college at the University of Cincinnati in March 1998. Its programs originated from various colleges at the University of Cincinnati.
In 2016, a set of 355 genes likely present in the LUCA was identified. A total of 6.1 million prokaryotic genes from Bacteria and Archaea were sequenced, identifying 355 protein clusters from among 286,514 protein clusters that were probably common to the LUCA. The results suggest that the LUCA was anaerobic with a Wood–Ljungdahl (reductive Acetyl-CoA) pathway, nitrogen- and carbon-fixing, thermophilic. Its cofactors suggest dependence upon an environment rich in hydrogen, carbon dioxide, iron, and transition metals. Its genetic material was probably DNA, requiring the 4-nucleotide genetic code, messenger RNA, transfer RNA, and ribosomes to translate the code into proteins such as enzymes. LUCA likely inhabited an anaerobic hydrothermal vent setting in a geochemically active environment. It was evidently already a complex organism, and must have had precursors; it was not the first living thing. The physiology of LUCA has been in dispute. Previous research identified 60 proteins common to all life. Metabolic reactions inferred in LUCA are the incomplete reverse Krebs cycle, gluconeogenesis, the pentose phosphate pathway, glycolysis, reductive amination, and transamination.
== Function == The ELN gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Multiple transcript variants encoding different isoforms have been found for this gene. Elastin's soluble precursor is tropoelastin.
Natural fibers are also used in composite materials, much like synthetic or glass fibers. These composites, called biocomposites, are a natural fiber in a matrix of synthetic polymers. One of the first biofiber-reinforced plastics in use was a cellulose fiber in phenolics in 1908. Usage includes applications where energy absorption is important, such as insulation, noise absorbing panels, or collapsable areas in automobiles. Natural fibers can have different advantages over synthetic reinforcing fibers. Most notably they are biodegradable and renewable. Additionally, they often have low densities and lower processing costs than synthetic materials. Design issues with natural fiber-reinforced composites include poor strength (natural fibers are not as strong as glass fibers) and difficulty with actually bonding the fibers and the matrix. Hydrophobic polymer matrices offer insufficient adhesion for hydrophilic fibers.
Sources: en.wikipedia.org
On 7 April, Trump announced that the US and Iran had reached an agreement based on the 10-point proposal mediated by Pakistani prime minister Shehbaz Sharif and Field Marshal Asim Munir. The US, Israel, and Iran agreed to a two-week ceasefire, under which Iran would re-open the Strait of Hormuz. After the announcement, Iran's Lavan Island oil refinery and Sirri Island crude export facilities were struck; no party claimed responsibility. In response, Iran continued missile and drone strikes on Gulf Arab states. The refinery attack was later revealed to have been done secretly by the UAE.
Medina expressed concern about the lack of legal certainty, the weakness of the political opposition, and skepticism regarding the negotiations over Annex C of the Itaipu Treaty, stating that any eventual benefits would primarily favor Brazil. Santiago Peña was criticized for his decision not to attend the funeral of Pope Francis. Peña's absence was regarded as a lack of reciprocity toward the affection shown by Francis for Paraguay, a deeply Catholic nation. Instead, Peña opted for an eleven-day trip to the United States to receive a private award. Peña has also attracted criticism for his international trips, which have been perceived as excessive. By mid-May 2025, Peña was estimated to have made more than 40 international trips as head of state, at a cost of ₲4.000 billion (or US$585,000), and to have spent a total of 126 days outside Paraguayan territory. His supporters have defended these measures, arguing that they attract more private investment to Paraguay.
Arab and Persian chemists distilled crude oil to produce flammable products for military purposes. Through Islamic Spain, distillation became available in Western Europe by the 12th century. It was present in Romania since the 13th century, being recorded as păcură. Sophisticated oil pits, 4.5 to 6 metres (15 to 20 ft) deep, were dug by the Seneca people and other Iroquois in Western Pennsylvania as early as 1415–1450. The French General Louis-Joseph de Montcalm encountered Seneca using petroleum for ceremonial fires and as a healing lotion during a visit to Fort Duquesne in 1750. Early British explorers to Myanmar documented a flourishing oil extraction industry based in Yenangyaung that, in 1795, had hundreds of hand-dug wells under production. Merkwiller-Pechelbronn is said to be the first European site where petroleum has been explored and used.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
== Mode of action == When used as a food additive, ractopamine added to feed can be distributed by the blood to the muscle tissues, where it serves as a full agonist to murine (mouse or rat) TAAR1, a receptor protein (not necessarily in humans). It is also an agonist to beta-adrenergic receptors and a dopamine releasing agent. A cascade of events will then be initiated to increase protein synthesis, which results in increased muscle fiber size. Ractopamine is known to increase the rate of weight gain, improve feed efficiency, and increase carcass leanness in finishing swine. Its use in finishing swine yields about 3 kg (6.6 lb) of additional lean pork per animal, and improves feed efficiency by 10%. In cattle on 28 January 2004 Elanco Animal Health made Optaflexx commercially available in the US. Optaflexx is a "medicated feed additive that is labeled only for use in steers or market heifers (not breeding heifers or bulls) during the last 28–42 days on feed."
Sources: en.wikipedia.org
==== ATP replenishment by nucleoside diphosphate kinases ==== ATP can also be synthesized through several so-called "replenishment" reactions catalyzed by the enzyme families of nucleoside diphosphate kinases (NDKs), which use other nucleoside triphosphates as a high-energy phosphate donor, and the ATP:guanido-phosphotransferase family.
A change in pressure at any point in an enclosed incompressible fluid at rest is transmitted equally and undiminished to all points in all directions throughout the fluid, and the force due to the pressure acts at right angles to the enclosing walls.
=== Evolution of plant morphology === Transcription factors and transcriptional regulatory networks play key roles in plant morphogenesis and their evolution. During plant landing, many novel transcription factor families emerged and are preferentially wired into the networks of multicellular development, reproduction, and organ development, contributing to more complex morphogenesis of land plants.
== Clinical studies == Randomized trials have evaluated Dexcom systems as part of real-time CGM-based diabetes management. In the 2020 MILLENNIALS crossover trial, participants aged 16–24 years with type 1 diabetes used the Dexcom G6 for eight weeks and conventional self-monitoring of blood glucose for eight weeks. During G6 use, the mean percentage of time in the target glucose range of 70–180 mg/dL was 35.7%, compared with 24.6% during self-monitoring, and mean glycated hemoglobin (HbA1c) was 0.76 percentage points lower. The 2021 MOBILE trial randomly assigned 175 adults with poorly controlled type 2 diabetes, treated with basal insulin but not mealtime insulin, to use either the G6 or a conventional blood glucose meter for eight months. HbA1c decreased by 1.1 percentage points in the G6 group and by 0.6 points in the meter group; after adjustment, the between-group difference was 0.4 percentage points. Mean time in the 70–180 mg/dL range was 59% with the G6 and 43% with meter monitoring, while one participant in each group experienced severe hypoglycemia. The study and devices were funded by Dexcom, and a Dexcom employee was among the authors. Both trials compared a CGM-enabled management strategy with fingerstick-based monitoring; they did not compare the G6 with another CGM system.
Sources: en.wikipedia.org
Semax is a synthetic seven-amino-acid peptide derived from a fragment of corticotropin. It is used in Russia as a nasal preparation, while elsewhere it is studied as a research compound. It is not approved as a medicine in most countries.
Its sequence corresponds to the 4-10 region of corticotropin extended by three residues. This fragment lacks the region responsible for adrenal steroid release, so it is explored for neural rather than hormonal effects. The relationship explains the compound's classification among ACTH-derived peptides.
It holds approval in Russia for several neurological indications as a nasal spray or drop formulation. Regulatory agencies in the United States and the European Union have not approved it. Products sold elsewhere are generally labeled for research use only.
Reversed-phase high-performance liquid chromatography is the standard method, with detection in the ultraviolet range. Peak area percentage yields a purity figure for the main component. Mass spectrometry is normally run alongside to confirm molecular identity.